InsideDarkWeb.com
  1. All Categories
  2. Bioinformatics

Bioinformatics : Recent Questions and Answers

Find answers to your questions about Bioinformatics or help others by answering their Bioinformatics questions.

Coronavirus RNA structures?

Is there anything known about the RNA structures of coronaviruses? More specifically - do they have any interesting known structures in the translatable region, like RRE of HIV or the...

Asked on 11/29/2021

1 answer

calculating nucleotide frequency per column

I have some sequences shown belowCAGGTAGCCCCGGTCAGAAGGGTTTGATTGGTGAGGCAAGTATGAACTGTATGCCTGGTAACCTATGTACTGGCTGTGAGACAGGTGGGCTCAGTGAGAGGGGTGAGTTGGGTATGTGAGGTGAGACAGGTGGAGEach line has 9 nucleotides.Consider it to be 9 columns.I want to calculate the nucleotide frequency of each nucleotide for each of the...

Asked on 11/27/2021

7 answer

Is it possible for coronavirus or SARS to be synthetic?

I have heard several conspiracy theories regarding the origin of the new coronavirus, 2019-nCov. For example that the virus and/or SARS were produced in a laboratory or were some variant...

Asked on 11/27/2021

1 answer

Extract sequences from partial Header

I have a library I would like to split them based on their headers. Some are related to RNA and DNA. The header contains much information, but the most important...

Asked on 11/24/2021

2 answer

Subsetting from seurat object based on orig.ident?

I am pretty new to Seurat. I want to subset from my original seurat object (BC3) meta.data based on orig.ident. however, when i use subset(), it returns with Error.ER_HER_P...

Asked on 11/24/2021

2 answer

Is there a way to measure cell line similarity using python?

I have a list of cell lines that should be compared against another list of cell lines as pairs. I am trying to find a way in order for me...

Asked on 11/17/2021

1 answer

P-value correction when evaluating correlation between gene and miRNA expression

First of all I apologize without the question is very basic, I am taking my first steps in bioinformatics.Data informationWe are evaluating the correlation (using the Pearson, Kendall or Spearman...

Asked on 11/15/2021

1 answer

Separating peaks of chip-seq with specific length

My data contain several chip-seq results. I have the peaks called by MACS2.I wanted to only look at those peaks that their size is e.g 500bp to 1000bp. How can...

Asked on 11/15/2021

2 answer

How to run MaxQuant in command line mode?

MaxQuant is a software package for mass spectroscopy and proteomics. There is a windows version and a linux version. To run on linux you have to use a program that...

Asked on 11/12/2021

2 answer

Why does the FASTA sequence for coronavirus look like DNA, not RNA?

I'm looking at a genome sequence for 2019-nCoV on NCBI. The FASTA sequence looks like this:>MN988713.1 Wuhan seafood market pneumonia virus isolate 2019-nCoV/USA-IL1/2020, complete genomeATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTG... ...TTAATCAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCACCGAGGCCACGCGGAGTACGATCGAGTGTACAGTGAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAATTTTAGTAGTGCTATCCCCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAACoronavirus...

Asked on 11/12/2021

4 answer

Ask a Question

Get help from others!

© 2021 InsideDarkWeb.com. All rights reserved.